View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11292_high_11 (Length: 240)
Name: NF11292_high_11
Description: NF11292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11292_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 30399444 - 30399218
Alignment:
| Q |
1 |
ctagcacacaagctcaatgcaatggcgctttctctcttattatgcttgctttatttttacattcaataataatgctannnnnnnatgccata---atgaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
30399444 |
ctagcacacaagctcaatgcaatggcgctttctctcttattatgcttgctttatttttacattcaataataatgctatttttttatgccataggaatgaa |
30399345 |
T |
|
| Q |
98 |
aaatatattaaattagtagactctggtgtacattgctgggtatgatgcagttgctgactcccaaacacggttctgacaagtagggttgcaagggtaggta |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30399344 |
aaatatattaaattagtagactctagtgtacattgctgggtatgatgcagttgctgactcccaaacacggttctgacaagtagggttgcaagggtaagta |
30399245 |
T |
|
| Q |
198 |
caatctatctcacgtgaaggacttctt |
224 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
30399244 |
cagtctatctcacgtgaaggacttctt |
30399218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 30389453 - 30389406
Alignment:
| Q |
160 |
aaacacggttctgacaagtagggttgcaagggtaggtacaatctatct |
207 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || | ||||||||||| |
|
|
| T |
30389453 |
aaacacggttatgacaagtagggttgcaaggataaggacaatctatct |
30389406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University