View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11292_low_7 (Length: 321)
Name: NF11292_low_7
Description: NF11292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11292_low_7 |
 |  |
|
| [»] scaffold1033 (1 HSPs) |
 |  |  |
|
| [»] scaffold1029 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 61 - 304
Target Start/End: Original strand, 28569266 - 28569509
Alignment:
| Q |
61 |
aaacacgtgattgtatgcagcttgggacacgatactaaatatgaacacttcttacaatccaaatttgaattttatcccgtcatgctgtgagaggctaagc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28569266 |
aaacacgtgattgtatgcagcttgggacacgatactaaatatggacacttcttacaattcaaatttgaattttatcccgtcatgctgtgagaggctaagc |
28569365 |
T |
 |
| Q |
161 |
gcttgtgctttaccaaacttcgtttgnnnnnnnnnnnnncttataaaatagtagtaatatgttgaatcaagaatgacatattaaaaacttatttggtgtt |
260 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28569366 |
gcttgtgctttaccaaacttcctttgtttttttctttttcttataaaatagtagtaatatgttgaatcaagaatgacatattaaaaacttatttggtgtt |
28569465 |
T |
 |
| Q |
261 |
ggtttcaagaatgacatatttttaatttcgagaataatataact |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28569466 |
ggtttcaagaatgacatatttttaatttcgagaatagtataact |
28569509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1033 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1033
Description:
Target: scaffold1033; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 239
Target Start/End: Complemental strand, 2417 - 2381
Alignment:
| Q |
203 |
ataaaatagtagtaatatgttgaatcaagaatgacat |
239 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
2417 |
ataaaatagtagtaatacgtggaatcaagaatgacat |
2381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1029 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1029
Description:
Target: scaffold1029; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 239
Target Start/End: Complemental strand, 2417 - 2381
Alignment:
| Q |
203 |
ataaaatagtagtaatatgttgaatcaagaatgacat |
239 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
2417 |
ataaaatagtagtaatacgtggaatcaagaatgacat |
2381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University