View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_high_27 (Length: 244)
Name: NF11293A_high_27
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_high_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 35976502 - 35976725
Alignment:
| Q |
20 |
attttaagactcaaattttagacttattttttaaaggctacgacggccgtactcttcgtcgtgtctgatatctaactctcgacaaaatacacactctaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35976502 |
attttaagactcaaattttagacttattttttaaaggctacgacggccgtactcttcgtcgtgtctgatatctaactctcgacaaaatacacactctaac |
35976601 |
T |
|
| Q |
120 |
aaaattacagacaatgctatccnnnnnnnnaatttagtttgatgtactatcatgtaacccttaacacctccatgagatagcgtgctattaaatttacgaa |
219 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
35976602 |
aaaattacagacaatgctatcc-tttttttaatttagtttgatgtactatcatgtaacccttaaaacctcaatgagatagcgtgtaattaaatttacgaa |
35976700 |
T |
|
| Q |
220 |
cgctttttctaaccaaagaaaatta |
244 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
35976701 |
cgctttttgtaaccaaagaaaatta |
35976725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University