View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11293A_low_100 (Length: 302)

Name: NF11293A_low_100
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11293A_low_100
NF11293A_low_100
[»] chr2 (2 HSPs)
chr2 (1-293)||(13960318-13960610)
chr2 (101-284)||(13967491-13967674)
[»] chr4 (2 HSPs)
chr4 (88-285)||(49870992-49871189)
chr4 (168-282)||(49865135-49865249)
[»] scaffold0618 (1 HSPs)
scaffold0618 (149-189)||(6835-6875)
[»] chr8 (3 HSPs)
chr8 (149-189)||(44067730-44067770)
chr8 (149-189)||(44087534-44087574)
chr8 (149-189)||(44093036-44093076)


Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 13960610 - 13960318
Alignment:
1 gaaatgacaactttggaaaacaaagccacttgagctgtcggatttggttcttccatcggcagctacgaaacattgttgttcttctaatggttttcttacg 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13960610 gaaatgacaactttggaaaacaaagccacttgagctgtcagatttggttcttccatcggcagctacgaaacattgttgttcttctaatggttttcttacg 13960511  T
101 attagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattgacgttgggattcgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13960510 attagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattgacgttgggattcgg 13960411  T
201 cgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcggagtgcaactgcttgatgtttctctg 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13960410 cgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcggagtgcaactgcttgatgtttctctg 13960318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 101 - 284
Target Start/End: Complemental strand, 13967674 - 13967491
Alignment:
101 attagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattgacgttgggattcgg 200  Q
    ||||||||||| |||||||||||| |||||||||| ||  | |  | |||||||||||||||||||  ||||||||||||||||||||||||||||| |     
13967674 attagtttgcaattttggaaaactccaaaggcgtcgccaaaaacaaagtcgattgtgccagagatggcgcagtcacggtagaattgacgttgggattgga 13967575  T
201 cgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcggagtgcaactgcttgat 284  Q
    || |||||||  ||||| |||| || ||||| ||||||| ||| |||||||  ||||||||||||||||| |||||||||||||    
13967574 cgtagagtgtgtcttggaaaccgtccatttgacagttgtggaatattgcttgatctgctgttactcggagggcaactgcttgat 13967491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 88 - 285
Target Start/End: Original strand, 49870992 - 49871189
Alignment:
88 tggttttcttacgattagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattga 187  Q
    ||||||||| ||||| ||||||||||||||||||||| |||  || |||||  |||  | ||||||||| || |  ||| ||||||| |||||||||||     
49870992 tggttttctaacgatgagtttgcagttttggaaaactccaactgcatcaccaaagacaaagtcgattgttccggtaatggtgcagtcgcggtagaattgt 49871091  T
188 cgttgggattcggcgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcggagtgcaactgcttgatg 285  Q
    | || |||||  | | |||||||  |||||||||| |  ||||  ||||||||||| | |||||||||||||||||| ||||| || |||||||||||    
49871092 cttttggattgtgtgtagagtgtatcttggtaaccgttcatttcacagttgtagaacaatgctttgtctgctgttacacggagggccactgcttgatg 49871189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 168 - 282
Target Start/End: Original strand, 49865135 - 49865249
Alignment:
168 tgcagtcacggtagaattgacgttgggattcggcgaagagtgttgcttggtaaccatctatttggcagttgtagaagattgctttgtctgctgttactcg 267  Q
    ||||||| ||||||||||| | || |||||  | | |||||||  |||||||||| || ||||| ||||||||||| | |||||||||||||||||| ||    
49865135 tgcagtcgcggtagaattgtcttttggattgtgtgtagagtgtatcttggtaaccgtccatttgacagttgtagaacaatgctttgtctgctgttacacg 49865234  T
268 gagtgcaactgcttg 282  Q
    ||| || ||||||||    
49865235 gagggccactgcttg 49865249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0618 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0618
Description:

Target: scaffold0618; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Complemental strand, 6875 - 6835
Alignment:
149 tcgattgtgccagagatgctgcagtcacggtagaattgacg 189  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
6875 tcgattgttccatagatgttgcagtcacggtagaattgacg 6835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 44067730 - 44067770
Alignment:
149 tcgattgtgccagagatgctgcagtcacggtagaattgacg 189  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44067730 tcgattgttccatagatgttgcagtcacggtagaattgacg 44067770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Complemental strand, 44087574 - 44087534
Alignment:
149 tcgattgtgccagagatgctgcagtcacggtagaattgacg 189  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44087574 tcgattgttccatagatgttgcagtcacggtagaattgacg 44087534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 44093036 - 44093076
Alignment:
149 tcgattgtgccagagatgctgcagtcacggtagaattgacg 189  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44093036 tcgattgttccatagatgttgcagtcacggtagaattgacg 44093076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University