View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_112 (Length: 290)
Name: NF11293A_low_112
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_112 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 31658741 - 31658583
Alignment:
| Q |
1 |
atgtaactttgaattttgttttgattatttgagacatgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattt |
100 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658741 |
atgtaactttgaagtttattttgattatttgagacgtgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattt |
31658642 |
T |
 |
| Q |
101 |
tgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658641 |
tgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
31658583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 290
Target Start/End: Complemental strand, 31658558 - 31658529
Alignment:
| Q |
261 |
taatgggagatttatttgatcgtttaactt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaactt |
31658529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University