View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_123 (Length: 281)
Name: NF11293A_low_123
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_123 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 7 - 263
Target Start/End: Original strand, 12271081 - 12271337
Alignment:
| Q |
7 |
caactgcaatacgcggtaaagtatggttagactaaaccaatcaggccttgtcgtactgcatcatgcaattcttgaggatgaaggaatctattcatttgtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271081 |
caactgcaatacgcggtaaagtatggttagactaaaccaattaggccttgtcgtactgcatcatgcaattcttgaggatgaaggaatctattcatttgtt |
12271180 |
T |
 |
| Q |
107 |
gtccctgagcacaagctaaaataaagcttgattctttgtctccgacatcttggcaaggatgcgcttcttaagcaaaagacctcagagttggttgtactga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271181 |
gtccctgagcacaagctaaaataaagcttgattctttgtctccgacatcctggcaaggatgcacttcttaagcaaaagacctcagagttggttgtactga |
12271280 |
T |
 |
| Q |
207 |
taatctctctgttaaaatggttaaaagagaaaacaaataaggcttcattggaatgaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271281 |
taatctctctgttaaaatggttaaaagagaaaacaaataaggcttcattggaatgaa |
12271337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University