View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_127 (Length: 277)
Name: NF11293A_low_127
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_127 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 6 - 277
Target Start/End: Complemental strand, 30590494 - 30590224
Alignment:
| Q |
6 |
agaaacaaagacacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgg |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590494 |
agaaacaaagatacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgg |
30590395 |
T |
 |
| Q |
106 |
gtatttgtctggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagctg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590394 |
gtatttgtctggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagctg |
30590295 |
T |
 |
| Q |
206 |
aatgtcagattgcttgatcagttcccnnnnnnntcccagtgaaagtgctgctgtagactgcaatagcaatga |
277 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590294 |
aatgtcagattgcttgatcagttcccaaaaaaa-cccagtgaaagtgctgctgtagactgcaatagcaatga |
30590224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University