View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_151 (Length: 260)
Name: NF11293A_low_151
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_151 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 248
Target Start/End: Original strand, 33063877 - 33064122
Alignment:
| Q |
2 |
caaatgagttttagctcgggacggactaactcttataatcattgacaatggccttctttttatnnnnnnnnntgctaatatttgaccatactatatactc |
101 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
33063877 |
caaatgagttttagctcgggacggactgactcttataatcattgacaatggccttctttttattaaaaaaa-tgctaatatttgacaatactatatactc |
33063975 |
T |
|
| Q |
102 |
tcagtctttctgatgcatgatgatggttatctataccgttttctaaaaacataacatattaaatcattcattctaactgaactgatcttgtacaacagtt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33063976 |
tcagtctttctgatgcatgatgatggttatctataccgttttctaaaaacataacatattaaatcattcattctaactgaactgatcttgtacaacagtt |
33064075 |
T |
|
| Q |
202 |
gatcaaataaatgtccgttaaatactgttcatactgggcatgatatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33064076 |
gatcaaataaatgtccgttaaatactgttcatactgggcatgatatt |
33064122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University