View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_157 (Length: 257)
Name: NF11293A_low_157
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_157 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 21 - 252
Target Start/End: Original strand, 28298745 - 28298974
Alignment:
| Q |
21 |
atcaccgctgccaactcacccacctcactgagtcgactcactcacacnnnnnnnnnttcaacaccataacaactcgacttcgcccaactcgctgagtcaa |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28298745 |
atcaccgctgccaactcgcccacctcactgagtcgactcactcaca--aaaaaaaatccaacaccataacaactcgactccgcccaactcgctgagtcaa |
28298842 |
T |
|
| Q |
121 |
ctcgcgaacaacaacaaccaaatccaaaatcacagcaactagctaatcacaaccacaacaattttccatgtgccttagctttgcagattctattcaatct |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28298843 |
ctcgcgcacaacaacaaccaaatccaaaatcacagtaactagctagtcacaaccgcaacaattttccatgtgccttagctttgccgattctattcaatct |
28298942 |
T |
|
| Q |
221 |
tagaccattttcatgtaactgttcaactgggt |
252 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |
|
|
| T |
28298943 |
tagaccattttcatgtgactgttcaactgggt |
28298974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University