View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_165 (Length: 253)
Name: NF11293A_low_165
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_165 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 1329436 - 1329676
Alignment:
| Q |
13 |
aatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaacatgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329436 |
aatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaacatgc |
1329535 |
T |
|
| Q |
113 |
tagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacatgaaccggaagaggatatgaatga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1329536 |
tagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaatgc |
1329635 |
T |
|
| Q |
213 |
agtcaaggcccttccaccacaagaggacccagccgaagaag |
253 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
1329636 |
agtcaaggcccttccaccaccagaggaaccagccgaagaag |
1329676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University