View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_167 (Length: 252)
Name: NF11293A_low_167
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_167 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 26580408 - 26580629
Alignment:
| Q |
19 |
attgttatcactataaagagggattccattgaagggtcttaatctaactaagttttttctcttccaaacactctcagcttcagaaaaagtagttgttttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26580408 |
attgttatcactataaagagggattccattgaagggtcttaatctaacaaagttttttctcttccaaacactctcagcttcagaaaaagtagttgttttt |
26580507 |
T |
|
| Q |
119 |
gttttggaatttgataatgaaagttctgtatcagttttttgtagagtactatttcttatcgaagatgaaaaaccatcactatgagatttgaaaccttcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26580508 |
gttttggaatttgataatgaaagttctgtatcagttttttgtagagtactatttcttattgaagatgaaaaaccatcactatgagatttgaaaccttcat |
26580607 |
T |
|
| Q |
219 |
gagtaatagcatcattaatatt |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26580608 |
gagtaatagcatcattaatatt |
26580629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University