View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_174 (Length: 250)
Name: NF11293A_low_174
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_174 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 5509192 - 5509053
Alignment:
| Q |
1 |
atgttaaggtattcaatggtcaaagaaacagctaaaggaaactcactgtgagatgaagatgttgcaatgtcttcacttgtttcacataggttaaggaact |
100 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509192 |
atgttaaggtcttcattgttcaaagaaacagctaaaggaaactcactgtgagatgaagatgttgcaatgtcttcacttgtttcacataggttaaggaact |
5509093 |
T |
|
| Q |
101 |
caatgttttcttgaccagaaactacaatgcaaactacaac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509092 |
caatgttttcttgaccagaaactacaatgcaaactacaac |
5509053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University