View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_179 (Length: 250)
Name: NF11293A_low_179
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_179 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 24094630 - 24094872
Alignment:
| Q |
8 |
ttggtgtttgaattttataggaaagagtttactcttttaaagtagtccatgtatgatgtatcaaaagaagatagaggtacttgtatcataaaatggagat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24094630 |
ttggtgtttgaattttataggaaagagtttactcttttaaagtagtccatgtatgatgtatcaaaagaagatagaggtacttgtatcataaaaaggagat |
24094729 |
T |
|
| Q |
108 |
atctattgcaccaagcaccctcttggaacttatttaattgttttttgcataatgtcaatataatattattttcgtcttcatagtgagtaatcaagtagtt |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24094730 |
atctattgcaccaagcaccttcttggaacttatttaattgttttttgcataatgtcaatataatattattttcttcttcatagtgagtaatcaagtagtt |
24094829 |
T |
|
| Q |
208 |
cttttgatttccctccattgagtattcgactagttctgttgat |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24094830 |
cttttgatttccctccattgagtaatcgactagttctgttgat |
24094872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University