View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_19 (Length: 433)
Name: NF11293A_low_19
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 9e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 192 - 337
Target Start/End: Complemental strand, 48669387 - 48669242
Alignment:
| Q |
192 |
aagactaccaacctcagcactaaacacaacaagtagaattggtatagtgaacaaataaacaccatggtttatcagataatggtaacccaatttcacatac |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669387 |
aagactaccaacctcagcactaaacacaacaagtagaattggtatagtgaacaaataaacaccatggtttatcagataatggtaacccaatttcacatac |
48669288 |
T |
|
| Q |
292 |
ttaaggttcacagattgaagaaaatccggtaaccgtctccgaacac |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669287 |
ttaaggttcacagattgaagaaaatccggtaaccgtctccgaacac |
48669242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University