View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_192 (Length: 246)
Name: NF11293A_low_192
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_192 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 35977667 - 35977885
Alignment:
| Q |
1 |
atcaaacctcgtggtacaatgataaaactttggataaagaaagaaagatcctcctaaatccaacgataaatatgttccggtttactttatggtggcgcga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35977667 |
atcaaaccacgtggtacaatgataaaactttggataaagaaagaaagatcct---aaatccaacgataaatatgtttcggtttactttatgg-------- |
35977755 |
T |
|
| Q |
101 |
cgtgtgacaaaaaagcgcgttagtctttgtttgggaccataacagaaaattcagtgacgcttctccgaaacttcctcgattccgtattatttttaccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35977756 |
-gtgtgacaaaaaagcgcgttagtctttgtttgggaccataacagaaaattcagtgacgcttctccgaaacttcctcgattccgtattattttcaccttt |
35977854 |
T |
|
| Q |
201 |
tccttttgctccttctaccttttccttctat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35977855 |
tccttttgctccttctaccttttccttctat |
35977885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University