View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_193 (Length: 246)
Name: NF11293A_low_193
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_193 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 24 - 235
Target Start/End: Original strand, 19558998 - 19559209
Alignment:
| Q |
24 |
actgaaccaggctacttcaaaagatgacactaaagaatatttatcagaaatgatatttttgacaacacaaatgttgccatgacaccatataatgacaatg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19558998 |
actgaaccaggctacttcaaaagatgacactaaagaatatttatcagaaatgatatttttgacaacacaaatgttgccatgacaccatataatgacaatg |
19559097 |
T |
|
| Q |
124 |
ttgtgggtttttctattgaactttcctctctttcggtcacttccacagttgtgttggccgttggaagtattttcattcctgtgcaggaacggttttgaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19559098 |
ttgtgggtttttctattgaactttcctctctttcggtcacttccacagttgtgttggccgttggaagtattttcattcatgtgcaggaacggttttgaat |
19559197 |
T |
|
| Q |
224 |
ttgtgatgtcca |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19559198 |
ttgtgatgtcca |
19559209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University