View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_194 (Length: 245)
Name: NF11293A_low_194
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_194 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 245
Target Start/End: Original strand, 43703074 - 43703304
Alignment:
| Q |
15 |
acatcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703074 |
acatcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtt |
43703173 |
T |
 |
| Q |
115 |
taaacttggttttattcacattacttttatcaccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaattt |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703174 |
taaactttgttttattcacattacttttatcgccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaattt |
43703273 |
T |
 |
| Q |
215 |
agtttttgtgaatcaagcaaattctgttggg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43703274 |
agtttttgtgaatcaagcaaattctgttggg |
43703304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University