View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_196 (Length: 245)
Name: NF11293A_low_196
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_196 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 6 - 128
Target Start/End: Complemental strand, 56487624 - 56487502
Alignment:
| Q |
6 |
actgagaagaaaccaaatctgccaagagatttcacttacagaggcagttagtttgagcggcggagtgatttagggtttcagttcctctcactgctatgcg |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56487624 |
actgaaaagaaaccaaatctgccaagagattttacttacagaggcagttagtttgagcggcggagtgatttagggtttcagttcctctcactgctatgcg |
56487525 |
T |
 |
| Q |
106 |
atttactagtactagtatattcc |
128 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
56487524 |
atttactagtactagtatattcc |
56487502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University