View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_203 (Length: 244)
Name: NF11293A_low_203
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_203 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 224
Target Start/End: Complemental strand, 39495616 - 39495413
Alignment:
| Q |
23 |
atcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495616 |
atcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatt |
39495517 |
T |
 |
| Q |
123 |
tgtgaatacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgataattacataagttgttatgttagtcatc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495516 |
tgtgaatacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattacataagttgttatgttagtcatc |
39495417 |
T |
 |
| Q |
221 |
gtat |
224 |
Q |
| |
|
|||| |
|
|
| T |
39495416 |
gtat |
39495413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University