View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_210 (Length: 243)
Name: NF11293A_low_210
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_210 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 30573653 - 30573876
Alignment:
| Q |
20 |
tttcagatatcattgtgagatccgttgaggataatattaagggtaaattttttataatatgaatgtaaccatgactagtagtgatatttcttttaatctc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30573653 |
tttcagatatcattgtgagatccgttgaggataatattatgggtaaactttttataatatgaatgtaaccatgactagtaatgatatttcttttaatctc |
30573752 |
T |
|
| Q |
120 |
tctcacaaaccaaatataaatacactgataaaccattaagcatatgtttggataaacattttcttgcattatatgttatatctactgtgaatttgcggaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30573753 |
tctcacaaaccaaatataaatacactgataaaccattaagcatatgtttggataaacattttcttgcattatatgttatatctactgtgaatttgcagaa |
30573852 |
T |
|
| Q |
220 |
gcaacaaaaccaagctttcacatt |
243 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30573853 |
gcaacaaaaccaagctttcacatt |
30573876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 120 - 243
Target Start/End: Original strand, 30570277 - 30570400
Alignment:
| Q |
120 |
tctcacaaaccaaatataaatacactgataaaccattaagcatatgtttggataaacattttcttgcattatatgttatatctactgtgaatttgcggaa |
219 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30570277 |
tctcacaagccaaatataaatacactaataaaccattaagcatatgtttggataaacattttcttgcattatatgttatatctactgtgaatttgcagaa |
30570376 |
T |
|
| Q |
220 |
gcaacaaaaccaagctttcacatt |
243 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30570377 |
gcaacaaaaccaagctttcacatt |
30570400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University