View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_219 (Length: 241)
Name: NF11293A_low_219
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_219 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 235
Target Start/End: Complemental strand, 40688431 - 40688199
Alignment:
| Q |
3 |
tcataaaggatctaacatattgaatgattggagcataaggatgaatgtatataggattagtccttacactcagattctatcagattggagatagtcttgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40688431 |
tcataaaggatctaacatattgaatgatgggagcataaggatgagtgtatataggattattccttacactcagattctatcagattggagatagtcttgc |
40688332 |
T |
|
| Q |
103 |
agttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcaaaaccaaactatgagcaaaattgcatgtaattccacatcgatat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40688331 |
agttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcagaaccaaactatgagcaaaattgcatgtaattcaacatcgatat |
40688232 |
T |
|
| Q |
203 |
tataagtatagtcaataacctaatattattgga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40688231 |
tataagtatagtcaataacctaatattattgga |
40688199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University