View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_220 (Length: 241)
Name: NF11293A_low_220
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_220 |
 | |
|
| [»] scaffold0110 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 13061 - 13269
Alignment:
| Q |
18 |
aaagattttgcggattatgcagatttttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13061 |
aaagattttgcggattatgcagatttttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttg |
13160 |
T |
|
| Q |
118 |
gttatgatactggcttttttgcccctggaaggtgttcgaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13161 |
gttatgatactggcttttttgcccctggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
13260 |
T |
|
| Q |
218 |
tttgatatt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
13261 |
tttgatatt |
13269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 20798 - 21006
Alignment:
| Q |
18 |
aaagattttgcggattatgcagatttttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20798 |
aaagattttgcggattatgcagatttttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttg |
20897 |
T |
|
| Q |
118 |
gttatgatactggcttttttgcccctggaaggtgttcgaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20898 |
gttatgatactggcttttttgcccctggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
20997 |
T |
|
| Q |
218 |
tttgatatt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
20998 |
tttgatatt |
21006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #3
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 29918 - 30126
Alignment:
| Q |
18 |
aaagattttgcggattatgcagatttttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
29918 |
aaagattttgcggattatgcagatttttgttttaagacatttggagacagagttaagaattggatgaccttcaatgaaccaagagttgttgctgcacttg |
30017 |
T |
|
| Q |
118 |
gttatgatactggcttttttgcccctggaaggtgttcgaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaa |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30018 |
gttatgataatggcttttttgcccctggaagatgttcaaaagaatatggaaattgtacagctggaaattcaggaactgagccttatactgtagctcacaa |
30117 |
T |
|
| Q |
218 |
tttgatatt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
30118 |
tttgatatt |
30126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 97
Target Start/End: Original strand, 31639059 - 31639108
Alignment:
| Q |
48 |
ttcaaaacatttggagacagagttaagaactggatgactttcaatgaacc |
97 |
Q |
| |
|
|||||| | |||||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
31639059 |
ttcaaagcttttggagacagagttaagcactggattaccttcaatgaacc |
31639108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University