View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_227 (Length: 239)
Name: NF11293A_low_227
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_227 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 65 - 239
Target Start/End: Complemental strand, 39299808 - 39299634
Alignment:
| Q |
65 |
ggaaaagaagattttggtggttttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaacagatgatagagaaaaacttgatagccgaaccaaag |
164 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39299808 |
ggaaaagaagattttggtggtgttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaaccgatgatagagaaaaacttgatagccgaaccaaag |
39299709 |
T |
|
| Q |
165 |
tggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaacaggacaagttgtggccgagaaaggaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39299708 |
tggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaacaggacaagttgtggcagagaaaggaa |
39299634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 39299840 - 39299804
Alignment:
| Q |
18 |
gtgcacatgttcgtgatagtgcaaatgtagcaggaaa |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299840 |
gtgcacatgttcgtgatagtgcaaatgtagcaggaaa |
39299804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University