View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_229 (Length: 239)
Name: NF11293A_low_229
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_229 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 239
Target Start/End: Complemental strand, 45123577 - 45123350
Alignment:
| Q |
12 |
atgaagaccgttaaaaatacatttaatcaatacatcatcactaatattcataatattctgtaatagacattcatagaaggatacatttgagaaacatttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45123577 |
atgaagaccgttaaaaatacatttaatcaatacatcatcactaatattcataatattttgtaatagacattcatagaaggatatatttgagaaacatttt |
45123478 |
T |
|
| Q |
112 |
tcatagttgaagacaaaattgtgttggaaaagatcaacatagagacaataaagaaacacaatcacaacataggtggaaacttcaaaaagcggagacgaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45123477 |
tcatagttgaagacaaaattgtgttggaaaagatcaacatagagaaaataaagaaacacaatcacaacataggtagaaacttcaaaaagcggagacgaaa |
45123378 |
T |
|
| Q |
212 |
ctatgaacattgtccaataacaactaga |
239 |
Q |
| |
|
|||||| ||||||||||| ||||||||| |
|
|
| T |
45123377 |
ctatgatcattgtccaatgacaactaga |
45123350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University