View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_232 (Length: 238)
Name: NF11293A_low_232
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_232 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 27 - 215
Target Start/End: Complemental strand, 38001290 - 38001102
Alignment:
| Q |
27 |
acattcttgacaacatgcttgcaaactaggtactcctacaacaaatgatttttcaccactgttaatcataaattcacacctccccaaatggatacgtgaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38001290 |
acattcttgacaacatgcttgcaaactaggtactcctacaacaaatgatttttcaccactgttaatcataaatttacacctccccaaatggatacgtgaa |
38001191 |
T |
 |
| Q |
127 |
gttcaatgtgcatggtgcaatttttctacaccaaaatcatgtcggaataggaacttgtgtgatgaatatggattgacatcttatcatgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38001190 |
gttcaatgtgcatggtgcaatttttctacaccaaaatcatgtcggaataggaacttgtgtgatgaatatggattgacatcttatcatgg |
38001102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University