View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_233 (Length: 236)
Name: NF11293A_low_233
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_233 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 49165582 - 49165389
Alignment:
| Q |
17 |
gttcctgaggtatgccaacaaaagtatataatcaatttacaaataagctatgtctatttgtaaaactacaatagttgcannnnnnnnncttgattctagt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49165582 |
gttcctgaggtatgccaacaaaagtatataatcaatttacaaataagctatgtctatttgtaaaactacaatagttgcattttttt--cttgattctagt |
49165485 |
T |
|
| Q |
117 |
gttgtcaatcgtgagtcatnnnnnnntagaggattattcaagctgcattgtagtgccactaaacaacattttgtattaaatagtgtatggtagaac |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49165484 |
gttgtcaatcgtgagtcataaaaaaatagaggattattcaagctgcattgtagtgccactaaacaacattttgtattaaatagtgtatggtagaac |
49165389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University