View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_242 (Length: 233)
Name: NF11293A_low_242
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_242 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 112 - 210
Target Start/End: Complemental strand, 33923708 - 33923610
Alignment:
| Q |
112 |
gactcatttttatcctggtgaattcgcatggtgaccctcatttttaggataaattatcgtgtcaaacgtggaggaatgatatgagcatgagaataatat |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33923708 |
gactcatttttatcctggtgaatccgcatggtgaccctcatttttaggataaattatcgtgtcaaacgtggaggaatgatatgagcatgagaataatat |
33923610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University