View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_245 (Length: 232)
Name: NF11293A_low_245
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_245 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 31 - 209
Target Start/End: Complemental strand, 54428799 - 54428610
Alignment:
| Q |
31 |
tcatagacttcactctagagttgaaagagtttacttagtacaaaaataactttttatacatccatcattacaatatcnnnnnnngagggaatcattacaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54428799 |
tcatagacttcactctagagttgaaagagtttacttagtacaaaaataacttcttatacatccatcattacaatatctttttttgagggaatcattacaa |
54428700 |
T |
 |
| Q |
131 |
tatctaaacacaacttaataccatattgttatgagtgtgga-----------ataaaagtggtgcaaatgatgatgacatggcaaataag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54428699 |
tatctaaacacaacttaataccatattgttatgagtgtggaatgcccaattgataaaagtggtgcaaatgatgatgacatggcaaataag |
54428610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University