View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11293A_low_245 (Length: 232)

Name: NF11293A_low_245
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11293A_low_245
NF11293A_low_245
[»] chr4 (1 HSPs)
chr4 (31-209)||(54428610-54428799)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 31 - 209
Target Start/End: Complemental strand, 54428799 - 54428610
Alignment:
31 tcatagacttcactctagagttgaaagagtttacttagtacaaaaataactttttatacatccatcattacaatatcnnnnnnngagggaatcattacaa 130  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||       ||||||||||||||||    
54428799 tcatagacttcactctagagttgaaagagtttacttagtacaaaaataacttcttatacatccatcattacaatatctttttttgagggaatcattacaa 54428700  T
131 tatctaaacacaacttaataccatattgttatgagtgtgga-----------ataaaagtggtgcaaatgatgatgacatggcaaataag 209  Q
    |||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||    
54428699 tatctaaacacaacttaataccatattgttatgagtgtggaatgcccaattgataaaagtggtgcaaatgatgatgacatggcaaataag 54428610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University