View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_253 (Length: 230)
Name: NF11293A_low_253
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_253 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 74 - 213
Target Start/End: Complemental strand, 10274788 - 10274649
Alignment:
| Q |
74 |
aagaaattgtaaatgaacggttaagtttggatgacacattttgcttatgtaagccaaagtttatttccacttcattagtctttggctttttatgaacttt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274788 |
aagaaattgtaaatgaacggttaagtttggatgacacattttgcttatgtaagccaaagtttatttccacttcattagtctttggctttttatgaacttt |
10274689 |
T |
|
| Q |
174 |
tctttatctaacttcattttatcattaccctatttcattt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10274688 |
tctttatctaacttcattttatcattaccctatttcattt |
10274649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 142 - 213
Target Start/End: Complemental strand, 10266805 - 10266734
Alignment:
| Q |
142 |
acttcattagtctttggctttttatgaacttttctttatctaacttcattttatcattaccctatttcattt |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| |||||||| |||||| ||||||||| |
|
|
| T |
10266805 |
acttcattagtctttggctttttctgaacatttctttatctaactttattttatcgttaccccatttcattt |
10266734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University