View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_258 (Length: 230)
Name: NF11293A_low_258
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_258 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 22044114 - 22043901
Alignment:
| Q |
12 |
tattcctattttaaatgtcttcgctatttctggaaaaatatctttatacaactatccaaccaattattattttattcaatgaaacatatgtaatgaatga |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22044114 |
tattcctattttaaatgtctttgctatttttggaaaaatatctttatacaactatccaaccaattattattttattcaatgaaacatatgtaatgaatga |
22044015 |
T |
|
| Q |
112 |
taaatttatatctatatatacatcactttatgttacaacaagttcatgacttttacaatatacttgatctttcagatgaaacctataacaaaattacttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22044014 |
taaatttatatctatatatacatcactttatgttacaacaagttcatgacttttacaatatacttgatctttcagatggaacctataacaaaattacttc |
22043915 |
T |
|
| Q |
212 |
tatccaatcctatt |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22043914 |
tatccaatcctatt |
22043901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University