View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_265 (Length: 229)
Name: NF11293A_low_265
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_265 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 25 - 179
Target Start/End: Complemental strand, 28519269 - 28519115
Alignment:
| Q |
25 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519269 |
aacctgtgtccaaaagagcaacaactatgtcgcgttctaatttcaatcttctcttggcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtg |
28519170 |
T |
|
| Q |
125 |
tagcttacggtattgatttttaaacaccaaaagtacttcatccatggctacacat |
179 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519169 |
taacttacggtattgatttttaaacaccaaaagtacttcatccatggctacacat |
28519115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 73 - 142
Target Start/End: Original strand, 12728763 - 12728832
Alignment:
| Q |
73 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggtattgatt |
142 |
Q |
| |
|
|||||||||| |||| ||||| ||||| |||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12728763 |
ttctcttagctgtcaatggtaatccaataaagtcccatgatcttgttgtgtgtagcttgcggtattgatt |
12728832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 136
Target Start/End: Complemental strand, 34291425 - 34291362
Alignment:
| Q |
73 |
ttctcttagcagtcagaggtaaaccaatgaagttccatgatcttgttgtgtgtagcttacggta |
136 |
Q |
| |
|
|||||||||| |||| |||||| ||||| || | |||||||||||||||||||||||| ||||| |
|
|
| T |
34291425 |
ttctcttagctgtcaaaggtaatccaataaaatcccatgatcttgttgtgtgtagcttgcggta |
34291362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University