View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11293A_low_266 (Length: 229)

Name: NF11293A_low_266
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11293A_low_266
NF11293A_low_266
[»] chr3 (1 HSPs)
chr3 (124-229)||(34142475-34142580)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 34142580 - 34142475
Alignment:
124 tactggattctgtctcacggataactctgttcgattgtagagttgccaaagccaaatgttatcaagggagagattaatcaagatattaaaagtcactttg 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
34142580 tactggattctgtctcacggataactctgttcgattgtagagttgccaaagccaaatgttattaagggagagattaatcaagatattaaaagtcactttg 34142481  T
224 aaactg 229  Q
    ||||||    
34142480 aaactg 34142475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University