View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_270 (Length: 228)
Name: NF11293A_low_270
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_270 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 49563496 - 49563287
Alignment:
| Q |
19 |
catcatgtaaaggattgaaagaaccaggcagtattattttcctttctactggtatctctgaaaccagagaataaaaaactatcaataacaaagtaaatcg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49563496 |
catcatgtaaaggattgaaagaaccaggcagtattattttcctttctgctggtatctctgaaaccagagaataaaaaattatcaataacaaagtaaatcg |
49563397 |
T |
 |
| Q |
119 |
tcattgtaactgtaataatattgcttctgcacaaaggtttaactataccacttctaaatggataaatcttgaagcatatttgaccatttataagttgctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563396 |
tcattgtaactgtaataatattgcttctgcacaaaggtttaactataccacttctaaatggataaatcttgaagcatatttgaccatttataagttgctc |
49563297 |
T |
 |
| Q |
219 |
taactcttga |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
49563296 |
taactcttga |
49563287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University