View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_287 (Length: 220)
Name: NF11293A_low_287
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_287 |
 | |
|
| [»] scaffold0683 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0683 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: scaffold0683
Description:
Target: scaffold0683; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 30 - 106
Target Start/End: Original strand, 3854 - 3930
Alignment:
| Q |
30 |
aaaacaaaacttttcatcttttacgatcgtgattcattattccacaactgcttctccccttccattcattttcatca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3854 |
aaaacaaaacttttcatcttttacgatcgtgattcattattccacaattgcttctccccttccattcattttcatca |
3930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0683; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 114 - 201
Target Start/End: Original strand, 3968 - 4055
Alignment:
| Q |
114 |
gctgcctatcttacgaccatcagttctcaccgctgctgtctgtcacctacctatcgagcaccacctctcatcgccgttgtcgcctgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||| |
|
|
| T |
3968 |
gctgcctatcttacgaccatcagttctcaccgctgctgtctgtcacctacctatcgagcaccacctctcaccgttgttgtcgactgat |
4055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University