View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_293 (Length: 214)
Name: NF11293A_low_293
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_293 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 31 - 193
Target Start/End: Original strand, 41899416 - 41899570
Alignment:
| Q |
31 |
attattctatagtcatgaggggaatcacttgaattgtttggataaattggattagattaaatttttatgggnnnnnnn-taattctattagttnnnnnnn |
129 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
41899416 |
attattttatagtcatgaaaggaatcacttgaattgtttggat---------tagattaaatttttatgggaaaaaaaataattctattagttaaaaaaa |
41899506 |
T |
 |
| Q |
130 |
gtctttcgaatgagcagaatagacttaacaacagttccaatgtacaatataatacgaagaatgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41899507 |
gtctttcgaatgagcagaatagacttaacaacagttccaatatacaatataatacgaagaatgt |
41899570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University