View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_300 (Length: 209)
Name: NF11293A_low_300
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_300 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 21 - 191
Target Start/End: Complemental strand, 9338665 - 9338495
Alignment:
| Q |
21 |
tcatggacttcgggttgcaggttaaacttaatttttaccattttggatgggtcactgcctatttggatttcgacaaagtccccgtttggttttagtcgtt |
120 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
9338665 |
tcatggacttcgggttgcaggtcaaacttaatttttatcattttggatgggtcgctgcctatttggatttcgacaaagtccccgtctggttctagtcgtt |
9338566 |
T |
 |
| Q |
121 |
ctagattctttattgctttgataagcaacccttcttcgcctttgttgattagccttgtttcgcttccaaca |
191 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9338565 |
ctagattctttattgctttgataagcagcccttcgtcgtctttgttgattagccttgtttcgcttccaaca |
9338495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University