View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_305 (Length: 207)
Name: NF11293A_low_305
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_305 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 31 - 93
Target Start/End: Original strand, 379156 - 379218
Alignment:
| Q |
31 |
tggaccagtggcggatcttgactaaagatgttgagggtgtcaaatatttgtataacgcacaca |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || || |||||||||||| ||| |||||| |
|
|
| T |
379156 |
tggaccagtggcggatcttgactaaagatgttggggctgccaaatatttgtaaaacacacaca |
379218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University