View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_313 (Length: 203)
Name: NF11293A_low_313
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_313 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 83 - 203
Target Start/End: Complemental strand, 2282270 - 2282150
Alignment:
| Q |
83 |
ctgacgcaattaactccttattctaagaatttgactcttatatgtaaacattattttggtgttaataattttgcagtatgtggtactagctccttgggtg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2282270 |
ctgacgcaattaactccttattctaagaatttgactcttatatgtaaacattattttggtgttaataattttgcagtatgtggtactagctccttgggtg |
2282171 |
T |
 |
| Q |
183 |
attcacagcacatattctttg |
203 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2282170 |
attcacagcacatattctttg |
2282150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University