View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_314 (Length: 201)
Name: NF11293A_low_314
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_314 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 34 - 187
Target Start/End: Complemental strand, 10598971 - 10598818
Alignment:
| Q |
34 |
agaagctgctttacaggtctttaatgacatggaagatcgcaatgtcataacttggacctctatcataaatggttttgcaaaacatgggtttgctacaaaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
10598971 |
agaagctgctttacaggtctttaatgacatggaagattgcaatgtcataacttggacctctatcataaatggttttgcaaaacatggatttgcttcaaaa |
10598872 |
T |
 |
| Q |
134 |
gcactagaattgttctatgatatgctcaaaacaggtgtgaaacctaatgatgtc |
187 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
10598871 |
gcactagaattgttctataatatgcttgaaacaggtgtgaagcctaatgatgtc |
10598818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University