View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_56 (Length: 364)
Name: NF11293A_low_56
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_56 |
 |  |
|
| [»] scaffold0421 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0421 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 33 - 160
Target Start/End: Complemental strand, 13397 - 13270
Alignment:
| Q |
33 |
tttttgtttgttggatctattcttttctttattatcattatttacaaagttaaattttttaatatttccatgccatgtcattggtggtagaaaagggtgt |
132 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13397 |
ttttcgtttgttggatctattcttttctttattatcattctttacatagttaaattttttaatatttccatgccatgtcatcggtggtagaaaagggtgt |
13298 |
T |
 |
| Q |
133 |
accaaaagagtggtacatgaatcttttt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13297 |
accaaaagagtggtacatgaatcttttt |
13270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 163 - 262
Target Start/End: Original strand, 42211920 - 42212019
Alignment:
| Q |
163 |
actttttgtgacgtgcactttctctgtccttttctacggttttcattttctctcaaatctaaacccttcttctcacactttttgcaactgtcacgtgtgg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42211920 |
actttttgtgacgtgcactttctctgtccttttctacggttttcattttctctcaaatctaaacccttcttctcacactttttgcaactgtcacgtgtgg |
42212019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 46 - 153
Target Start/End: Original strand, 47345444 - 47345551
Alignment:
| Q |
46 |
gatctattcttttctttattatcattatttacaaagttaaattttttaatatttccatgccatgtcattggtggtagaaaagggtgtaccaaaagagtgg |
145 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||| |||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
47345444 |
gatctattcttttcttttttatcattctttacaaagttaaattgtttaatatttccatgtcatgtcatcagtgctataaaagggtgtaccaaaagagtaa |
47345543 |
T |
 |
| Q |
146 |
tacatgaa |
153 |
Q |
| |
|
|||||||| |
|
|
| T |
47345544 |
tacatgaa |
47345551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 46 - 85
Target Start/End: Complemental strand, 3798110 - 3798071
Alignment:
| Q |
46 |
gatctattcttttctttattatcattatttacaaagttaa |
85 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
3798110 |
gatctattcttttcttttttatcattctttacaaagttaa |
3798071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University