View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293A_low_89 (Length: 317)
Name: NF11293A_low_89
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293A_low_89 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 15 - 180
Target Start/End: Original strand, 32907352 - 32907519
Alignment:
| Q |
15 |
atgaatgaataaatcaatgaaaatcctgacaaaatactctcactttat--cctatattatgtgtgaaccactcaataatcctcccattaattgtcactcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32907352 |
atgaatgaataaatcaatgaaaatcctgacaaaatactctcactttatatcctatattatgtatgaaccactcaataatcctcccactaattgtcactcc |
32907451 |
T |
|
| Q |
113 |
tctcttggttagcaaatcagcagaattgttggcttccctattcactcctctcttttgtattttctgtc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32907452 |
tctcttggttagcaaatcagcagaattgttggcttccctgttcactcctctcttttgtattttctgtc |
32907519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 193 - 310
Target Start/End: Original strand, 32907580 - 32907697
Alignment:
| Q |
193 |
tgtagcatgtcttaaaacttaatatattaaaccttatatggagggtattctgccattggatggatttgcttccaggtaactgtaatgaaatactactggc |
292 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32907580 |
tgtagcatgtcttaaaacttaatgtattaaactttatatggagggtattcttccattggatggatttgcttccaggtaattgtaatgaaatactactggc |
32907679 |
T |
|
| Q |
293 |
tttacactattgaaatct |
310 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
32907680 |
tttatactatcgaaatct |
32907697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University