View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11293_low_10 (Length: 221)
Name: NF11293_low_10
Description: NF11293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11293_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 48669383 - 48669174
Alignment:
| Q |
1 |
ctaccaacctcagcactaaacacaacaagtagaattggtatagtgaacaaataaacaccatggtttatcagataatggtaacccaatttcacatacttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669383 |
ctaccaacctcagcactaaacacaacaagtagaattggtatagtgaacaaataaacaccatggtttatcagataatggtaacccaatttcacatacttaa |
48669284 |
T |
|
| Q |
101 |
ggttcacagattgaagaaaatccggtaaccgtctccgaacacgaacagagaacgtcaatgaaccggcgttcggacccgatgattcaatcccacggttcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669283 |
ggttcacagattgaagaaaatccggtaaccgtctccgaacacggacagagaacgtcaatgaaccggcgttcggacccgatgattcaatcccacggttcac |
48669184 |
T |
|
| Q |
201 |
aatctctgct |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
48669183 |
aatctctgct |
48669174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University