View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_14 (Length: 396)
Name: NF11294_low_14
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 257
Target Start/End: Original strand, 16512904 - 16513157
Alignment:
| Q |
4 |
tttaagtcctttactccacagttctgtttgttacttattttaatttgcttctgtataggtggactaagttggttcaaaagccctatgagcagggtgatca |
103 |
Q |
| |
|
|||||| |||||| | |||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16512904 |
tttaagacctttatttcacagttctgattgttactttttttaatttgcttctatataggtggactaagttggttcaaaagccctatgagcagggtgatca |
16513003 |
T |
|
| Q |
104 |
aagagccctgaaattggtcaagggaattttgaggacattgatgttaaggagaaccaaggaaacaaaggataaagaaggaaggtagtcattctcacttcat |
203 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16513004 |
aagagccctaaaattggtcaagggaattttgaggacattgatgttaaggagaactaaggaaacaaaggataaagaaggaaggtagtcattctcacttcat |
16513103 |
T |
|
| Q |
204 |
gtgcactgtgtccctttcaatatgcatgtctgaatttatttataatgatatata |
257 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16513104 |
gtgcactgtgtctctttcaatatgcatgcctgaatttatttataatgatatata |
16513157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University