View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_19 (Length: 361)
Name: NF11294_low_19
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_19 |
 | |
|
| [»] scaffold0066 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 15 - 345
Target Start/End: Original strand, 7425576 - 7425906
Alignment:
| Q |
15 |
cacagattatttacgctgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtctgtctgtggtgttttct |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7425576 |
cacagattatttatgctgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtctgtctgtggtgttttct |
7425675 |
T |
|
| Q |
115 |
tgttgttgctgactgtggtgtttctgtcggtctgctgaagaggggatgttctcttaatgtctcgagcttttgtttggaagcagagggagtcttgtggtgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7425676 |
tgttgttgctgactgtggtgtttctgtcggtctgctgaagagggaatgttctcttaatgtctcgagcttttgtttggaagcagagggagtcttgtggtgc |
7425775 |
T |
|
| Q |
215 |
tgtgagtataggagctaaggtggttattattaaattacttcaatttggtagcaagaggatatggctttagcagggttgtaatttttggcatttgagagtg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7425776 |
tgtgagtataggagctaaggtggttattattaaattacttcaatttggtagcaagaggatatggctttagcagggttataatttttggcatttgagagtg |
7425875 |
T |
|
| Q |
315 |
ccttttctgtaacaggtgcaggagtctgttg |
345 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
7425876 |
ccttttctgtaacaggtgcaggcgtctgttg |
7425906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 31 - 217
Target Start/End: Complemental strand, 18139 - 17953
Alignment:
| Q |
31 |
tgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtctgtctgtggtgttttcttgttgttgctgactgt |
130 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||| || || |||||||||||||||||| |||||| ||||| ||||| ||||||| || ||||| |||| |
|
|
| T |
18139 |
tgtgtctgaaatatccgaagttgcggcagtttggcagttttttgattcatagtctgaggagggggtgtgtctatggtgctttcttgctgctgctggctgt |
18040 |
T |
|
| Q |
131 |
ggtgtttctgtcggtctgctgaagaggggatgttctcttaatgtctcgagcttttgtttggaagcagagggagtcttgtggtgctgt |
217 |
Q |
| |
|
|||||||| ||||| | ||| |||||||| ||||| || |||| | ||||||| |||||||||||||||||||| || |||||| |
|
|
| T |
18039 |
ggtgtttcggtcggccgtctgtagaggggacattctcatagggtctggtgcttttggttggaagcagagggagtcttatgatgctgt |
17953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University