View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_22 (Length: 350)
Name: NF11294_low_22
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 11976253 - 11976433
Alignment:
| Q |
43 |
ataatgaggtggggtggtggtttaccgttgcggatgaacggtcggtgtcttgggatgcttcgcggt-gagattgagggatggtctggctggttgttttag |
141 |
Q |
| |
|
|||||||| || || |||| ||||| |||| ||||||| |||||||||||||||||||||| | ||| || ||| ||||| ||||||||||||| | |
|
|
| T |
11976253 |
ataatgagatgagggggtgttttacggttgtcgatgaacagtcggtgtcttgggatgcttcgtagacgaggttaagg-atggtgtggctggttgtttgaa |
11976351 |
T |
|
| Q |
142 |
agagagaaaacgaaatgtgggtgttggaaatttcaaaccagttctaccggttgccagttacatggtttagtgaaaatagtga |
223 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||| ||||||||| |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
11976352 |
agagagaaaacaagatgtgggtgttggaattttaaaaccagttgtaccggttgccaattacatggtttagtgaatatagtga |
11976433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 289 - 330
Target Start/End: Complemental strand, 33346762 - 33346721
Alignment:
| Q |
289 |
tatatagaaatagcatgtacataactcttatatgattctctc |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33346762 |
tatatagaaatagcatgtacataactcttatatgattctctc |
33346721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 231
Target Start/End: Original strand, 6709923 - 6709993
Alignment:
| Q |
161 |
ggtgttggaaatttcaaaccagttctaccggttgccagttacatggtttagtgaaaatagtgatgtggcat |
231 |
Q |
| |
|
|||||||||| || ||||||| || |||||||||| |||| | |||||| |||||||| ||||||||||| |
|
|
| T |
6709923 |
ggtgttggaatttacaaaccaattgaaccggttgccggttagagggtttaatgaaaatattgatgtggcat |
6709993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University