View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_29 (Length: 265)
Name: NF11294_low_29
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 32811589 - 32811833
Alignment:
| Q |
1 |
ctaagtttaagcatctatatgttgaaaatattgttgacgttgttggagacattaattgtgaatttcgtgttattgctgcactactaggaaagggtgttga |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32811589 |
ctaagtttaagcgtctatatgttgaaaatattgttgacgttgttggagacattaattgtgaatttcgtgttattgttgcactactaggaaagggtgttga |
32811688 |
T |
 |
| Q |
101 |
attatggtctactatccttcatgatcttgtgagaaagcgaaacacgaaccataaagattacgttgaactcgaaggaacaagggaaggagctcatagattc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
32811689 |
attatggtctactatcgttcatgatcttgtgagaaagctaaacacgaaccataaagattatgtcgaactcgaaggaacgagggaaggagctcgtagattc |
32811788 |
T |
 |
| Q |
201 |
tttatggcccgtgaaatgtgtggaacatgcaccttcatcttgctc |
245 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32811789 |
tttatggccagtgaaatgtgtggaacatgcaccttcatcttgctc |
32811833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University