View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_32 (Length: 260)
Name: NF11294_low_32
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_32 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 260
Target Start/End: Complemental strand, 6489392 - 6489141
Alignment:
| Q |
9 |
agcacagaatcagacacggacaccagatacatcacggcagcagcaacaacgtcgtcaatgaatgctgtattaaattgcggttgcagtcacgaatgcggaa |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489392 |
agcacggaatcagacacggacaccagatacatcacggcagcagcaacaacgtcatcaatcaatgctgtattaaattgcggttgcagtcacgaatgcggaa |
6489293 |
T |
|
| Q |
109 |
ctcagcaccatcaaaacggttattctcaattgaatttggatccattaaagcagattgcatctctcttctgtgacaatgaagaaaccgaaccnnnnnnnnn |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489292 |
ctcagcaccatcaaaacggttattctcaattgaatttggatccattaaagcagattgcatctctcttctgtgacaatgaagaaaccgaaccaaaaaagca |
6489193 |
T |
|
| Q |
209 |
nnnnnnnnnnncagttacattttgaaatagagagatgaaataaagaagagat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489192 |
aaaaaagaaaacagttacattttgaaatagagagatgaaataaagaagagat |
6489141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University