View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_34 (Length: 249)
Name: NF11294_low_34
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 30261422 - 30261664
Alignment:
| Q |
8 |
gagcagagacataaaatgaggtcaaggcttcaaaccttaaaaactaacataactttggctataaacnnnnnnn-cctatcctgcacagtattgcaaactt |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30261422 |
gagcagggacataaaatgaggtcaaggcttcaaaccttaaaaattaacataactttggctataaacaaaaaaaacctatcctgcacagtattgcaaactt |
30261521 |
T |
 |
| Q |
107 |
ttctaaaatgcatgaggaacacaagtagaaccagcttctgcagcatctctattcaatgctttctctagccttgtctcaaatggcgtagcatgccaattca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30261522 |
ttctaaaatgcatgaggaacacaagtagaaccagcttctgcagcatctctattcaatgctttctctagccttgtctcaaatggcgtagcatgccaattca |
30261621 |
T |
 |
| Q |
207 |
ccttcttatcctgcacagccagttaaatatctaaataagaatt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30261622 |
ccttcttatcctgcacagccagttaaatatctaaataagaatt |
30261664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University