View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_35 (Length: 240)
Name: NF11294_low_35
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_35 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 32811372 - 32811595
Alignment:
| Q |
17 |
actctgcaagttaccctttacaaaggccaggagtgcagcttgaactctcgacaaagcgttcatctcnnnnnnnnnnnnnnnnnncagcatattgactcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||| ||||||||| | |
|
|
| T |
32811372 |
actctgcaagttaccctttacaaaggccaggagtgcagcttgaactgtcgacaaagcgttaatctctttttgttttgttttgttcagtatattgacttgt |
32811471 |
T |
|
| Q |
117 |
tccatgacagcaggtggctttctttgcctacgtcgcgcctagacagaatcagtgcacatctttttaagcctttatccgatgcaacgcctcatagcttaaa |
216 |
Q |
| |
|
| |||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32811472 |
tacatgacagaaggtggctttctttgcctacatcgcgcctagatagaatcagtgcacatctttttaagcctttatccgatgcaacgcctcatagcttgaa |
32811571 |
T |
|
| Q |
217 |
gtatattgattaaatgtctaagtt |
240 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
32811572 |
gtatattaattaaatgtctaagtt |
32811595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University