View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11294_low_37 (Length: 240)
Name: NF11294_low_37
Description: NF11294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11294_low_37 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 30261988 - 30261767
Alignment:
| Q |
19 |
gtggtggtattggtactcctgataggagcatctcacaacaaggttcaaattcagtgataagccttgaagataggcctattttaggtgctttaacaatgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30261988 |
gtggtggtattggtactcctgataggagcatctcacaacaaggttcaaattcagtgataagccttgaagataggcctattttaggtgctttaacaatgga |
30261889 |
T |
 |
| Q |
119 |
agagattaagcaattttccgctacatcgtccccaaggaagtcaccttgtaagagtccagatgagatgccgattataggaacagttgggtcctattggaat |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30261888 |
agagattaagcaattttccgctacgtcgtccccaaggaagtcaccttgtaagagtccagatgagatgccgattataggaacagttgggtcctattggaat |
30261789 |
T |
 |
| Q |
219 |
gctaatgagggttctggctcac |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30261788 |
gctaatgagggttctggctcac |
30261767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University